<?xml version="1.0" encoding="UTF-8"?>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" xmlns="http://purl.org/rss/1.0/" xmlns:dc="http://purl.org/dc/elements/1.1/">
  <channel rdf:about="https://www.alice.cnptia.embrapa.br/alice/handle/item/334">
    <title>DSpace Coleção: Nota Técnica/Nota científica (CPATSA)</title>
    <link>https://www.alice.cnptia.embrapa.br/alice/handle/item/334</link>
    <description>Nota Técnica/Nota científica (CPATSA)</description>
    <items>
      <rdf:Seq>
        <rdf:li rdf:resource="https://www.alice.cnptia.embrapa.br/alice/handle/doc/1179588" />
        <rdf:li rdf:resource="https://www.alice.cnptia.embrapa.br/alice/handle/doc/1139744" />
        <rdf:li rdf:resource="https://www.alice.cnptia.embrapa.br/alice/handle/doc/1139647" />
        <rdf:li rdf:resource="https://www.alice.cnptia.embrapa.br/alice/handle/doc/1139619" />
      </rdf:Seq>
    </items>
    <dc:date>2026-06-22T13:15:25Z</dc:date>
  </channel>
  <item rdf:about="https://www.alice.cnptia.embrapa.br/alice/handle/doc/1179588">
    <title>First report of maize-associated umbra-like virus in maize in Brazil.</title>
    <link>https://www.alice.cnptia.embrapa.br/alice/handle/doc/1179588</link>
    <description>Título: First report of maize-associated umbra-like virus in maize in Brazil.
Autoria: MACHADO, P. R. M. S.; BARROS JÚNIOR, M. P.; FONSECA, G. B. L.; MELO, G. E. F.; FREITAS, D. M. S.; NAGATA, T.
Conteúdo: To investigate the virome in maize plants, sixteen maize leaf samples with viral symptoms of yellow stripes from three Brazilian locations (Riacho Fundo/DF, Juazeiro/BA, and Uberlândia/MG) were pooled, and viral particles were semi- purified via differential centrifugation and a 20% sucrose cushion step. Semi-purified virus from gramineous plants showing yellow stripes (eight plants of Brachiaria spp. and twelve plants of Panicum spp. from Campo Grande, MS, Brazil) was also prepared using the same method aiming to investigate viruses associated with maize plants. Total RNA from two pooled samples was extracted using the Quick- RNA Plant Miniprep Kit (Zymo Research) and sequenced together by high-throughput sequencing (HTS) on the Illu- mina NovaSeq6000 platform, generating 10 G reads of 150 nt paired-ends for metagenomic analysis. The sequences were analyzed using bioinformatics methods as described by Blawid et al. (2017). A 3,006-nt contig, which had the higher identity with maize-associated umbra-like virus (MaULV) was assembled from 3,695 reads, with a cover- age of 182.4x. The genomic sequence of the MaULV isolate (LC851045) showed 97.41% identity with the Mexican iso- late (OK018180) and 95.52% with the Ecuadorian isolate (OM937759). The same maize leaf samples showing yel- low stripes used for the metagenomic study (16 samples) had been individually stored in an ultrafreezer and tested for MaULV by RT-PCR using the primers, Maize_Umbra_F (CGAAAATACAAGATCCAACCGA) and Maize_Umbra_R (ATCCGTCTGCCTTCAACCTC) targeting the open read- ing frame 2 of MaULV (593nt long). Total RNA form leaf samples was extracted using the Total RNA Purification kit (Cellco Biotec). cDNA was synthesized with M-MLV RT (Thermo Fisher Scientific) and amplified for PCR (Taq DNA Polymerase, Sinapse Biotecnologia). Two maize sam- ples from Juazeiro (BA) out of 16 were positive by RT-PCR, which were also confirmed by RT-qPCR using the GoTaq® qPCR Master Mix kit (Promega), with the primers Maize_ Umbra_qPCR_F (A G CGTGGAGCAATTGAGTC) and Maize_Umbra_qPCR_R (CATCGACCGACTTCAGCCAA). MaULV was not detected in other gramineous plants used for the metagenomic study. The two MaULV-positive samples were also positive for maize rayado fino virus and maize striate mosaic virus by RT-PCR, showing co-infec- tions. This is the first report of MaULV in Brazil.</description>
    <dc:date>2025-01-01T00:00:00Z</dc:date>
  </item>
  <item rdf:about="https://www.alice.cnptia.embrapa.br/alice/handle/doc/1139744">
    <title>Angico Anadenanthera colubrina var. cebil (Vell.) Brenan.</title>
    <link>https://www.alice.cnptia.embrapa.br/alice/handle/doc/1139744</link>
    <description>Título: Angico Anadenanthera colubrina var. cebil (Vell.) Brenan.
Autoria: NASCIMENTO, J. P. B.; BISPO, J. de S.; DANTAS, B. F.
Conteúdo: Angico (Anadenanthera colubrina var. cebil (Vell.) Brenan) (Figura 1) é uma árvore pertencente à família Fabaceae, sendo também conhecida popularmente como angico-de-caroço, angicovermelho, cambuí-angico, goma-de-angico, angico-de-casca. Tem como sinonímias científicas Anadenanthera macrocarpa (Benth.) Brenan, Piptadenia macrocarpa Benth., Acacia colubrina (Vell.) Mart. e Acacia cebil Griseb. (Morim, 2015).</description>
    <dc:date>2019-01-01T00:00:00Z</dc:date>
  </item>
  <item rdf:about="https://www.alice.cnptia.embrapa.br/alice/handle/doc/1139647">
    <title>Umburana-de-cheiro Amburana cearensis (Allemão) A. C. Sm.</title>
    <link>https://www.alice.cnptia.embrapa.br/alice/handle/doc/1139647</link>
    <description>Título: Umburana-de-cheiro Amburana cearensis (Allemão) A. C. Sm.
Autoria: ARAÚJO, M. do N.; DANTAS, B. F.
Conteúdo: Pertencente à família Fabaceae, é popularmente conhecida como imburana-de-cheiro, umburana-de-cheiro, cerejeira, cumaru (nordeste do Brasil), amburana, cumarudas- caatingas (Sudeste do Brasil), roble criollo (Argentina), tumi (Bolivia) e trébol (Paraguai) (Melo et al., 2015). A espécie tem como sinonímias botânicas Amburana cearensis var. acreana (Ducke) J.F.Macbr., A. claudii Schwacke &amp; Taub., Torresea acreana Ducke, T. cearensis Allemão (Salis e Crispim, 2006).</description>
    <dc:date>2019-01-01T00:00:00Z</dc:date>
  </item>
  <item rdf:about="https://www.alice.cnptia.embrapa.br/alice/handle/doc/1139619">
    <title>Mulungu Erythrina velutina Willd.</title>
    <link>https://www.alice.cnptia.embrapa.br/alice/handle/doc/1139619</link>
    <description>Título: Mulungu Erythrina velutina Willd.
Autoria: RIBEIRO, R. C.; DANTAS, B. F.
Conteúdo: O mulungu (Erythrina velutina Willd.) pertence à família Fabaceae, sendo conhecido também como: suinã, canivete, corticeira, pau-de-coral, sanaduí, sananduva, saranduba, maçaranduba, bico-de-pássaro. Tem como sinonímias científicas Chirocalyx velutinus Walp., Corallodendron velutinum (Willd.) Kuntze, Erythrina aculeatissima Desf., Erythrina aurantiaca Ridl., Erythrina splendida Diels. (Lorenzi &amp; Matos, 2008).</description>
    <dc:date>2019-01-01T00:00:00Z</dc:date>
  </item>
</rdf:RDF>

