Use este identificador para citar ou linkar para este item: http://www.alice.cnptia.embrapa.br/alice/handle/doc/103540
Unidade da Embrapa/Coleção:: Área de Informação da Sede - Artigo em periódico indexado (ALICE)
Data do documento: 2-Mai-2001
Tipo do Material: Artigo em periódico indexado (ALICE)
Autoria: ANUNCIACAO, C.E.
ASTOLFI FILHO, S.
Título: Paternity test in "mangalarga-marchador" equines by DNA-fingerprinting.
Edição: 2000
Fonte/Imprenta: Pesquisa Agropecuaria Brasileira, Brasilia, v.35, n.10, p.2007-15, out.2000.
Idioma: en
Palavras-chave: Equino
Equine
Conteúdo: Sondas moleculares de minissatelites CG-ricas isoladas do genoma humano tem apresentado pouca habilidade de individualizacao em cavalos. Neste trabalho foram isoladas novas sequencias de DNA, que podem ser utilizadas para teste de paternidade em cavalos. DNA genomico de cavalos Mangalarga-Marchador foi tratado com enzimas de restricao que digerem preferencialmente sequencias nao-repetitivas, preservando, assim, a estrutura onde os mini e microssatélites estao localizados. Quatro clones (S01, S05, S07 and S09), selecionados a partir de uma livraria genomica com o oligonucleotideo (TG)n, demonstraram um perfil de hibridizaçao semelhante com bandas do tipo DNA "fingerprinting". Utilizando estas sondas, o poder de individualizacao obtido foi de 10-8, 105 vezes mais elevado do que o obtido com a M13, outra sonda do tipo GC-rica. Todos os clones foram eficientes para a determinacao do parentesco em cruzamentos e apresentaram uma sequencia-consensus de 27 pb, GTTTCATTTATTATTCTTTGGAAGAAA, que estava repetida 12, 18, 11 e 21 vezes nos clones S01, S05, S07 e S09, respectivamente.
Ano de Publicação: 2000
Aparece nas coleções:Artigo em periódico indexado (AI-SEDE) / Embrapa Informação Tecnológica (SCT)

Arquivos associados a este item:
Arquivo Descrição TamanhoFormato 
pab99091.pdf348,7 kBAdobe PDFThumbnail
Visualizar/Abrir

FacebookTwitterDeliciousGoogle BookmarksMySpace